Skip to content

NEET-UG Biology

Reading the genetic code — practice questions

8 questions in the bank on this idea. Below are 8 of them, exactly as they appear in a test.

Take the free diagnostic

No signup. Answers and worked solutions come with your result.

  1. Question 1 · difficulty L1 · recall

    A property in which more than one codon can specify the same amino acid:

    • A. polarity
    • B. overlap
    • C. ambiguity
    • D. degeneracy

  2. Question 2 · difficulty L1 · recall

    The usual initiation codon in translation:

    • A. AUG
    • B. UAG
    • C. UGA
    • D. UAA

  3. Question 3 · difficulty L2 · understanding

    Who proposed that the genetic code for amino acids should be made up of three nucleotides?

    • A. Jacque Monod
    • B. Franklin Stahl
    • C. George Gamow
    • D. Francis Crick

  4. Question 4 · difficulty L3 · understanding

    The sixth mutant codon of beta globin gene causing polymerization of Haemoglobin and change in RBC shape is ____\_\_\_\_

    • A. GUG
    • B. AUG
    • C. GAG
    • D. CAG

  5. Question 5 · difficulty L3 · understanding

    The salient features of genetic code are : (A) The code is palindromic (B) UGA act as initiator codon (C) The code is unambiguous and specific (D) The code is nearly universal Choose the most appropriate answer from the options given below :

    • A. (A) and (D) only
    • B. (B) and (C) only
    • C. (A) and (B) only
    • D. (C) and (D) only

  6. Question 6 · difficulty L3 · understanding

    Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?

    • A. 3’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5’
    • B. 5’ ATCGATCGATCGATCGATCGATCGATCG 3’
    • C. 3’ ATCGATCGATCGATCGATCGATCGATCG 5’
    • D. 5’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3’

  7. Question 7 · difficulty L3 · understanding

    Statement I : The codon 'AUG' codes for methionine and phenylalanine. Statement II : 'AAA' and 'AAG' both codons code for the amino acid lysine. In the light of the above statements, choose the correct answer from the options given below.

    • A. Statement I is incorrect but Statement II is true
    • B. Both Statement I and Statement II are true
    • C. Both Statement I and Statement II are false
    • D. Statement I is correct but Statement II is false

  8. Question 8 · difficulty L3 · application

    Why is the genetic code described as degenerate?

    • A. Codons overlap extensively
    • B. One codon always specifies several amino acids
    • C. Several codons can specify one amino acid
    • D. Different species use entirely unrelated codon meanings

Want to know which of these you would get wrong?

Reading a question and answering it under a clock are different things. Take the 20-question diagnostic and see where the marks actually go.

Start the diagnostic →